Antibodies
Anti-MFG-E8 Antibody-Oligo Conjugate
SKU: aoc2703
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MFG-E8 Antibody-IF1
Antibody Target
- Target
- Lactadherin
- UniProt Number
- Q08431
- Target Description
- Plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. Promotes VEGF-dependent neovascularization (By similarity). Contributes to phagocytic removal of apoptotic cells in many tissues. Specific ligand for the alpha-v/beta-3 and alpha-v/beta-5 receptors. Also binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner. Zona pellucida-binding protein which may play a role in gamete interaction..; FUNCTION: [Medin]: Main constituent of aortic medial amyloid..
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC70281
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat