Antibodies
Anti- MGEA5/OGA Antibody-Oligo Conjugate
SKU: aoc1018
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti- MGEA5/OGA Antibody-IF1
Antibody Target
- Target
- Protein O-GlcNAcase
- UniProt Number
- O60502
- Target Description
- [Isoform 1]: Cleaves GlcNAc but not GalNAc from O-glycosylated proteins. Deglycosylates a large and diverse number of proteins, such as CRYAB, ELK1, GSDMD, LMNB1 and TAB1. Can use p-nitrophenyl-beta-GlcNAc and 4-methylumbelliferone-GlcNAc as substrates but not p-nitrophenyl-beta-GalNAc or p-nitrophenyl-alpha-GlcNAc (in vitro). Does not bind acetyl-CoA and does not have histone acetyltransferase activity.; FUNCTION: [Isoform 3]: Cleaves GlcNAc but not GalNAc from O-glycosylated proteins. Can use p-nitrophenyl-beta-GlcNAc as substrate but not p-nitrophenyl-beta-GalNAc or p-nitrophenyl-alpha-GlcNAc (in vitro), but has about six times lower specific activity than isoform 1.
- Molecular Weight
- 103 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC65434
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat