Antibodies
Anti-MGLL Antibody-Oligo Conjugate
SKU: aoc2707
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MGLL Antibody-IF1
Antibody Target
- Target
- Monoglyceride lipase
- UniProt Number
- Q99685
- Target Description
- Converts monoacylglycerides to free fatty acids and glycerol (PubMed:19029917, PubMed:20079333, PubMed:21049984, PubMed:22969151, PubMed:24368842). Hydrolyzes the endocannabinoid 2-arachidonoylglycerol, and thereby contributes to the regulation of endocannabinoid signaling, nociperception and perception of pain (PubMed:19029917, PubMed:20079333, PubMed:21049984, PubMed:22969151, PubMed:24368842). Regulates the levels of fatty acids that serve as signaling molecules and promote cancer cell migration, invasion and tumor growth (PubMed:20079333)..
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC58998
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat