Antibodies
Anti-MGLL Antibody-Oligo Conjugate
SKU: aoc2707
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MGLL Antibody-IF1
Antibody Target
- Target
- Monoglyceride lipase
- UniProt Number
- Q99685
- Target Description
- Converts monoacylglycerides to free fatty acids and glycerol. Hydrolyzes the endocannabinoid 2-arachidonoylglycerol, and thereby contributes to the regulation of endocannabinoid signaling, nociperception and perception of pain. Regulates the levels of fatty acids that serve as signaling molecules and promote cancer cell migration, invasion and tumor growth.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PIHCELISA
- Clone
- ARC58998
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat