Antibodies
Anti-MIF Antibody-Oligo Conjugate
SKU: aoc2715
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MIF Antibody-IF1
Antibody Target
- Target
- Macrophage migration inhibitory factor
- UniProt Number
- P14174
- Target Description
- Pro-inflammatory cytokine involved in the innate immune response to bacterial pathogens (PubMed:15908412, PubMed:17443469, PubMed:23776208). The expression of MIF at sites of inflammation suggests a role as mediator in regulating the function of macrophages in host defense (PubMed:15908412, PubMed:17443469, PubMed:23776208). Counteracts the anti-inflammatory activity of glucocorticoids (PubMed:15908412, PubMed:17443469, PubMed:23776208). Has phenylpyruvate tautomerase and dopachrome tautomerase activity (in vitro), but the physiological substrate is not known (PubMed:11439086, PubMed:17526494). It is not clear whether the tautomerase activity has any physiological relevance, and whether it is important for cytokine activity (PubMed:11439086, PubMed:17526494)..
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57867
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat