Antibodies
Anti-MIF Antibody-Oligo Conjugate
SKU: aoc2715
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MIF Antibody-IF1
Antibody Target
- Target
- Macrophage migration inhibitory factor
- UniProt Number
- P14174
- Target Description
- Pro-inflammatory cytokine involved in the innate immune response to bacterial pathogens. The expression of MIF at sites of inflammation suggests a role as mediator in regulating the function of macrophages in host defense. Counteracts the anti-inflammatory activity of glucocorticoids. Has phenylpyruvate tautomerase and dopachrome tautomerase activity (in vitro), but the physiological substrate is not known. It is not clear whether the tautomerase activity has any physiological relevance, and whether it is important for cytokine activity.
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57867
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat