Antibodies
Anti-MITF Antibody-Oligo Conjugate
SKU: aoc2717
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MITF Antibody-IF1
Antibody Target
- Target
- Microphthalmia-associated transcription factor
- UniProt Number
- O75030
- Target Description
- Transcription factor that acts as a master regulator of melanocyte survival and differentiation as well as melanosome biogenesis. Binds to M-boxes (5'-TCATGTG-3') and symmetrical DNA sequences (E-boxes) (5'-CACGTG-3') found in the promoter of pigmentation genes, such as tyrosinase (TYR). Involved in the cellular response to amino acid availability by acting downstream of MTOR: in the presence of nutrients, MITF phosphorylation by MTOR promotes its inactivation. Upon starvation or lysosomal stress, inhibition of MTOR induces MITF dephosphorylation, resulting in transcription factor activity. Plays an important role in melanocyte development by regulating the expression of tyrosinase (TYR) and tyrosinase-related protein 1 (TYRP1). Plays a critical role in the differentiation of various cell types, such as neural crest-derived melanocytes, mast cells, osteoclasts and optic cup-derived retinal pigment epithelium.
- Molecular Weight
- 59kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55801
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat