Antibodies
Anti-MITF Antibody-Oligo Conjugate
SKU: aoc2717
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MITF Antibody-IF1
Antibody Target
- Target
- Microphthalmia-associated transcription factor
- UniProt Number
- O75030
- Target Description
- Transcription factor that acts as a master regulator of melanocyte survival and differentiation as well as melanosome biogenesis (PubMed:10587587, PubMed:22647378, PubMed:27889061, PubMed:9647758). Binds to M-boxes (5'-TCATGTG-3') and symmetrical DNA sequences (E-boxes) (5'-CACGTG-3') found in the promoter of pigmentation genes, such as tyrosinase (TYR) (PubMed:10587587, PubMed:22647378, PubMed:27889061, PubMed:9647758). Involved in the cellular response to amino acid availability by acting downstream of MTOR: in the presence of nutrients, MITF phosphorylation by MTOR promotes its inactivation (PubMed:36608670). Upon starvation or lysosomal stress, inhibition of MTOR induces MITF dephosphorylation, resulting in transcription factor activity (PubMed:36608670). Plays an important role in melanocyte development by regulating the expression of tyrosinase (TYR) and tyrosinase-related protein 1 (TYRP1) (PubMed:10587587, PubMed:22647378, PubMed:27889061, PubMed:9647758). Plays a critical role in the differentiation of various cell types, such as neural crest-derived melanocytes, mast cells, osteoclasts and optic cup-derived retinal pigment epithelium (PubMed:10587587, PubMed:22647378, PubMed:27889061, PubMed:9647758)..
- Molecular Weight
- 59kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC55801
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat