Antibodies
Anti-Mitofilin Antibody-Oligo Conjugate
SKU: aoc2718
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Mitofilin Antibody-IF1
Antibody Target
- Target
- MICOS complex subunit MIC60
- UniProt Number
- Q16891
- Target Description
- Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Plays an important role in the maintenance of the MICOS complex stability and the mitochondrial cristae morphology.
- Molecular Weight
- 84 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC61198
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse