Antibodies
Anti-Mitofusin 1 Antibody-Oligo Conjugate
SKU: aoc2719
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Mitofusin 1 Antibody-IF1
Antibody Target
- Target
- Mitofusin-1
- UniProt Number
- Q8IWA4
- Target Description
- Mitochondrial outer membrane GTPase that mediates mitochondrial clustering and fusion. Membrane clustering requires GTPase activity. It may involve a major rearrangement of the coiled coil domains. Mitochondria are highly dynamic organelles, and their morphology is determined by the equilibrium between mitochondrial fusion and fission events. Overexpression induces the formation of mitochondrial networks (in vitro). Has low GTPase activity.
- Molecular Weight
- 84kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC54223
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human