Antibodies
Anti-MKL1 Antibody-Oligo Conjugate
SKU: aoc2722
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MKL1 Antibody-IF1
Antibody Target
- Target
- Myocardin-related transcription factor A
- UniProt Number
- Q969V6
- Target Description
- Transcription coactivator that associates with the serum response factor (SRF) transcription factor to control expression of genes regulating the cytoskeleton during development, morphogenesis and cell migration. The SRF-MRTFA complex activity responds to Rho GTPase-induced changes in cellular globular actin (G-actin) concentration, thereby coupling cytoskeletal gene expression to cytoskeletal dynamics. MRTFA binds G-actin via its RPEL repeats, regulating activity of the MRTFA-SRF complex. Activity is also regulated by filamentous actin (F-actin) in the nucleus.
- Molecular Weight
- 99 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC78147
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat