Antibodies
Anti-MLH1 Antibody-Oligo Conjugate (ARC53543)
SKU: aoc2724
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MLH1 Antibody (ARC53543)-IF1
Antibody Target
- Target
- DNA mismatch repair protein Mlh1
- UniProt Number
- P40692
- Target Description
- Heterodimerizes with PMS2 to form MutL alpha, a component of the post-replicative DNA mismatch repair system (MMR). DNA repair is initiated by MutS alpha (MSH2-MSH6) or MutS beta (MSH2-MSH3) binding to a dsDNA mismatch, then MutL alpha is recruited to the heteroduplex. Assembly of the MutL-MutS-heteroduplex ternary complex in presence of RFC and PCNA is sufficient to activate endonuclease activity of PMS2. It introduces single-strand breaks near the mismatch and thus generates new entry points for the exonuclease EXO1 to degrade the strand containing the mismatch. DNA methylation would prevent cleavage and therefore assure that only the newly mutated DNA strand is going to be corrected. MutL alpha (MLH1-PMS2) interacts physically with the clamp loader subunits of DNA polymerase III, suggesting that it may play a role to recruit the DNA polymerase III to the site of the MMR. Also implicated in DNA damage signaling, a process which induces cell cycle arrest and can lead to apoptosis in case of major DNA damages. Heterodimerizes with MLH3 to form MutL gamma which plays a role in meiosis..
- Molecular Weight
- 85 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC53543
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse