Antibodies
Anti-MLKL Antibody-Oligo Conjugate (AMC0729)
SKU: aoc2727
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MLKL Antibody (AMC0729)-IF1
Antibody Target
- Target
- Mixed lineage kinase domain-like protein
- UniProt Number
- Q8NB16
- Target Description
- Pseudokinase that plays a key role in TNF-induced necroptosis, a programmed cell death process. Does not have protein kinase activity. Activated following phosphorylation by RIPK3, leading to homotrimerization, localization to the plasma membrane and execution of programmed necrosis characterized by calcium influx and plasma membrane damage. In addition to TNF-induced necroptosis, necroptosis can also take place in the nucleus in response to orthomyxoviruses infection: following activation by ZBP1, MLKL is phosphorylated by RIPK3 in the nucleus, triggering disruption of the nuclear envelope and leakage of cellular DNA into the cytosol.following ZBP1 activation, which senses double-stranded Z-RNA structures, nuclear RIPK3 catalyzes phosphorylation and activation of MLKL, promoting disruption of the nuclear envelope and leakage of cellular DNA into the cytosol. Binds to highly phosphorylated inositol phosphates such as inositolhexakisphosphate (InsP6) which is essential for its necroptotic function.
- Molecular Weight
- 54 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- AMC0729
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouse