Antibodies
Anti-MMP13 Antibody-Oligo Conjugate
SKU: aoc2731
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MMP13 Antibody-IF1
Antibody Target
- Target
- Collagenase 3
- UniProt Number
- P45452
- Target Description
- Plays a role in the degradation of extracellular matrix proteins including fibrillar collagen, fibronectin, TNC and ACAN. Cleaves triple helical collagens, including type I, type II and type III collagen, but has the highest activity with soluble type II collagen. Can also degrade collagen type IV, type XIV and type X. May also function by activating or degrading key regulatory proteins, such as TGFB1 and CCN2. Plays a role in wound healing, tissue remodeling, cartilage degradation, bone development, bone mineralization and ossification. Required for normal embryonic bone development and ossification. Plays a role in the healing of bone fractures via endochondral ossification. Plays a role in wound healing, probably by a mechanism that involves proteolytic activation of TGFB1 and degradation of CCN2. Plays a role in keratinocyte migration during wound healing. May play a role in cell migration and in tumor cell invasion..
- Molecular Weight
- 54kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0528
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human