Antibodies
Anti-MMP14 Antibody-Oligo Conjugate
SKU: aoc2732
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MMP14 Antibody-IF1
Antibody Target
- Target
- Matrix metalloproteinase-14
- UniProt Number
- P50281
- Target Description
- Endopeptidase that degrades various components of the extracellular matrix such as collagen. Essential for pericellular collagenolysis and modeling of skeletal and extraskeletal connective tissues during development. Activates progelatinase A/MMP2, thereby acting as a positive regulator of cell growth and migration. Involved in the formation of the fibrovascular tissues in association with pro-MMP2. May be involved in actin cytoskeleton reorganization by cleaving PTK7. Acts as a regulator of Notch signaling by mediating cleavage and inhibition of DLL1. Cleaves ADGRB1 to release vasculostatin-40 which inhibits angiogenesis. Acts as a negative regulator of the GDF15-GFRAL aversive response by mediating cleavage and inactivation of GFRAL.
- Molecular Weight
- 66kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCFlow CytometryELISA
- Clone
- ARC0211
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat