Antibodies
Anti-Moesin Antibody-Oligo Conjugate
SKU: aoc2738
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Moesin Antibody-IF1
Antibody Target
- Target
- Moesin
- UniProt Number
- P26038
- Target Description
- Ezrin-radixin-moesin (ERM) family protein that connects the actin cytoskeleton to the plasma membrane and thereby regulates the structure and function of specific domains of the cell cortex. Tethers actin filaments by oscillating between a resting and an activated state providing transient interactions between moesin and the actin cytoskeleton. Once phosphorylated on its C-terminal threonine, moesin is activated leading to interaction with F-actin and cytoskeletal rearrangement. These rearrangements regulate many cellular processes, including cell shape determination, membrane transport, and signal transduction. The role of moesin is particularly important in immunity acting on both T and B-cells homeostasis and self-tolerance, regulating lymphocyte egress from lymphoid organs. Modulates phagolysosomal biogenesis in macrophages. Also participates in immunologic synapse formation.
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1258
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat