Antibodies
Anti-MOG Antibody-Oligo Conjugate
SKU: aoc2739
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MOG Antibody-IF1
Antibody Target
- Target
- Myelin-oligodendrocyte glycoprotein
- UniProt Number
- Q16653
- Target Description
- Mediates homophilic cell-cell adhesion (By similarity). Minor component of the myelin sheath. May be involved in completion and/or maintenance of the myelin sheath and in cell-cell communication..; FUNCTION: (Microbial infection) Acts as a receptor for rubella virus..
- Molecular Weight
- 28kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC0879
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 1-100 of human Myelin oligodendrocyte glycoprotein (NP_996532.2).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat