Antibodies

Anti-Mre11 Antibody-Oligo Conjugate

SKU: aoc2748

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Proximity Ligation Assay Oligossee protocol

PLA1 Oligo Details

5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'

View Paper

An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.

Anti-Mre11 Antibody-PLA1

Antibody Target

Target
Double-strand break repair protein MRE11
UniProt Number
P49959
Target Description
Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis (PubMed:11741547, PubMed:14657032, PubMed:22078559, PubMed:23080121, PubMed:24316220, PubMed:26240375, PubMed:27889449, PubMed:28867292, PubMed:29670289, PubMed:30464262, PubMed:30612738, PubMed:31353207, PubMed:37696958, PubMed:38128537, PubMed:9590181, PubMed:9651580, PubMed:9705271). The MRN complex is involved in the repair of DNA double-strand breaks (DSBs) via homologous recombination (HR), an error-free mechanism which primarily occurs during S and G2 phases (PubMed:24316220, PubMed:28867292, PubMed:31353207, PubMed:38128537). The complex (1) mediates the end resection of damaged DNA, which generates proper single-stranded DNA, a key initial steps in HR, and is (2) required for the recruitment of other repair factors and efficient activation of ATM and ATR upon DNA damage (PubMed:24316220, PubMed:27889449, PubMed:28867292, PubMed:36050397, PubMed:38128537). Within the MRN complex, MRE11 possesses both single-strand endonuclease activity and double-strand-specific 3'-5' exonuclease activity (PubMed:11741547, PubMed:22078559, PubMed:24316220, PubMed:26240375, PubMed:27889449, PubMed:29670289, PubMed:31353207, PubMed:36563124, PubMed:9590181, PubMed:9651580, PubMed:9705271). After DSBs, MRE11 is loaded onto DSBs sites and cleaves DNA by cooperating with RBBP8/CtIP to initiate end resection (PubMed:27814491, PubMed:27889449, PubMed:30787182). MRE11 first endonucleolytically cleaves the 5' strand at DNA DSB ends to prevent non-homologous end joining (NHEJ) and licence HR (PubMed:24316220). It then generates a single-stranded DNA gap via 3' to 5' exonucleolytic degradation to create entry sites for EXO1- and DNA2-mediated 5' to 3' long-range resection, which is required for single-strand invasion and recombination (PubMed:24316220, PubMed:28867292). RBBP8/CtIP specifically promotes the endonuclease activity of MRE11 to clear protein-DNA adducts and generate clean double-strand break ends (PubMed:27814491, PubMed:27889449, PubMed:30787182). MRE11 endonuclease activity is also enhanced by AGER/RAGE (By similarity). The MRN complex is also required for DNA damage signaling via activation of the ATM and ATR kinases: the nuclease activity of MRE11 is not required to activate ATM and ATR (PubMed:14657032, PubMed:15064416, PubMed:15790808, PubMed:16622404). The MRN complex is also required for the processing of R-loops (PubMed:31537797). The MRN complex is involved in the activation of the cGAS-STING pathway induced by DNA damage during tumorigenesis: the MRN complex acts by displacing CGAS from nucleosome sequestration, thereby activating it (By similarity). In telomeres the MRN complex may modulate t-loop formation (PubMed:10888888)..; FUNCTION: MRE11 contains two DNA-binding domains (DBDs), enabling it to bind both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA)..
Molecular Weight
81kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBELISAChIP
Clone
ARC0931
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouse