Antibodies
Anti-Mre11 Antibody-Oligo Conjugate
SKU: aoc2748
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Mre11 Antibody-PLA1
Antibody Target
- Target
- Double-strand break repair protein MRE11
- UniProt Number
- P49959
- Target Description
- Core component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis (PubMed:11741547, PubMed:14657032, PubMed:22078559, PubMed:23080121, PubMed:24316220, PubMed:26240375, PubMed:27889449, PubMed:28867292, PubMed:29670289, PubMed:30464262, PubMed:30612738, PubMed:31353207, PubMed:37696958, PubMed:38128537, PubMed:9590181, PubMed:9651580, PubMed:9705271). The MRN complex is involved in the repair of DNA double-strand breaks (DSBs) via homologous recombination (HR), an error-free mechanism which primarily occurs during S and G2 phases (PubMed:24316220, PubMed:28867292, PubMed:31353207, PubMed:38128537). The complex (1) mediates the end resection of damaged DNA, which generates proper single-stranded DNA, a key initial steps in HR, and is (2) required for the recruitment of other repair factors and efficient activation of ATM and ATR upon DNA damage (PubMed:24316220, PubMed:27889449, PubMed:28867292, PubMed:36050397, PubMed:38128537). Within the MRN complex, MRE11 possesses both single-strand endonuclease activity and double-strand-specific 3'-5' exonuclease activity (PubMed:11741547, PubMed:22078559, PubMed:24316220, PubMed:26240375, PubMed:27889449, PubMed:29670289, PubMed:31353207, PubMed:36563124, PubMed:9590181, PubMed:9651580, PubMed:9705271). After DSBs, MRE11 is loaded onto DSBs sites and cleaves DNA by cooperating with RBBP8/CtIP to initiate end resection (PubMed:27814491, PubMed:27889449, PubMed:30787182). MRE11 first endonucleolytically cleaves the 5' strand at DNA DSB ends to prevent non-homologous end joining (NHEJ) and licence HR (PubMed:24316220). It then generates a single-stranded DNA gap via 3' to 5' exonucleolytic degradation to create entry sites for EXO1- and DNA2-mediated 5' to 3' long-range resection, which is required for single-strand invasion and recombination (PubMed:24316220, PubMed:28867292). RBBP8/CtIP specifically promotes the endonuclease activity of MRE11 to clear protein-DNA adducts and generate clean double-strand break ends (PubMed:27814491, PubMed:27889449, PubMed:30787182). MRE11 endonuclease activity is also enhanced by AGER/RAGE (By similarity). The MRN complex is also required for DNA damage signaling via activation of the ATM and ATR kinases: the nuclease activity of MRE11 is not required to activate ATM and ATR (PubMed:14657032, PubMed:15064416, PubMed:15790808, PubMed:16622404). The MRN complex is also required for the processing of R-loops (PubMed:31537797). The MRN complex is involved in the activation of the cGAS-STING pathway induced by DNA damage during tumorigenesis: the MRN complex acts by displacing CGAS from nucleosome sequestration, thereby activating it (By similarity). In telomeres the MRN complex may modulate t-loop formation (PubMed:10888888)..; FUNCTION: MRE11 contains two DNA-binding domains (DBDs), enabling it to bind both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA)..
- Molecular Weight
- 81kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBELISAChIP
- Clone
- ARC0931
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse