Antibodies
Anti-MRP1 Antibody-Oligo Conjugate
SKU: aoc2749
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MRP1 Antibody-IF1
Antibody Target
- Target
- Multidrug resistance-associated protein 1
- UniProt Number
- P33527
- Target Description
- Mediates export of organic anions and drugs from the cytoplasm (PubMed:10064732, PubMed:11114332, PubMed:16230346, PubMed:7961706, PubMed:9281595). Mediates ATP-dependent transport of glutathione and glutathione conjugates, leukotriene C4, estradiol-17-beta-o-glucuronide, methotrexate, antiviral drugs and other xenobiotics (PubMed:10064732, PubMed:11114332, PubMed:16230346, PubMed:7961706, PubMed:9281595). Confers resistance to anticancer drugs by decreasing accumulation of drug in cells, and by mediating ATP- and GSH-dependent drug export (PubMed:9281595). Hydrolyzes ATP with low efficiency (PubMed:16230346). Catalyzes the export of sphingosine 1-phosphate from mast cells independently of their degranulation (PubMed:17050692). Participates in inflammatory response by allowing export of leukotriene C4 from leukotriene C4-synthesizing cells (By similarity). Mediates ATP-dependent, GSH-independent cyclic GMP-AMP (cGAMP) export (PubMed:36070769). Thus, by limiting intracellular cGAMP concentrations negatively regulates the cGAS-STING pathway (PubMed:36070769). Exports S-geranylgeranyl-glutathione (GGG) in lymphoid cells and stromal compartments of lymphoid organs. ABCC1 (via extracellular transport) with GGT5 (via GGG catabolism) establish GGG gradients within lymphoid tissues to position P2RY8-positive lymphocytes at germinal centers in lymphoid follicles and restrict their chemotactic transmigration from blood vessels to the bone marrow parenchyma (By similarity). Mediates basolateral export of GSH-conjugated R- and S-prostaglandin A2 diastereomers in polarized epithelial cells (PubMed:9426231)..
- Molecular Weight
- 172kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52207
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat