Antibodies
Anti-MRP4 Antibody-Oligo Conjugate (ARC52221)
SKU: aoc2750
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MRP4 Antibody (ARC52221)-IF1
Antibody Target
- Target
- ATP-binding cassette sub-family C member 4
- UniProt Number
- O15439
- Target Description
- ATP-dependent transporter of the ATP-binding cassette (ABC) family that actively extrudes physiological compounds and xenobiotics from cells. Transports a range of endogenous molecules that have a key role in cellular communication and signaling, including cyclic nucleotides such as cyclic AMP (cAMP) and cyclic GMP (cGMP), bile acids, steroid conjugates, urate, and prostaglandins (PubMed:11856762, PubMed:12523936, PubMed:12835412, PubMed:12883481, PubMed:15364914, PubMed:15454390, PubMed:16282361, PubMed:17959747, PubMed:18300232, PubMed:26721430). Mediates the ATP-dependent efflux of glutathione conjugates such as leukotriene C4 (LTC4) and leukotriene B4 (LTB4) too. The presence of GSH is necessary for the ATP-dependent transport of LTB4, whereas GSH is not required for the transport of LTC4 (PubMed:17959747). Mediates the cotransport of bile acids with reduced glutathione (GSH) (PubMed:12523936, PubMed:12883481, PubMed:16282361). Transports a wide range of drugs and their metabolites, including anticancer, antiviral and antibiotics molecules (PubMed:11856762, PubMed:12105214, PubMed:15454390, PubMed:17344354, PubMed:18300232). Confers resistance to anticancer agents such as methotrexate (PubMed:11106685)..
- Molecular Weight
- 150kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC52221
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human