Antibodies
Anti-MSH6 Antibody-Oligo Conjugate (ARC57727)
SKU: aoc2760
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MSH6 Antibody (ARC57727)-IF1
Antibody Target
- Target
- DNA mismatch repair protein Msh6
- UniProt Number
- P52701
- Target Description
- Component of the post-replicative DNA mismatch repair system (MMR). Heterodimerizes with MSH2 to form MutS alpha, which binds to DNA mismatches thereby initiating DNA repair. When bound, MutS alpha bends the DNA helix and shields approximately 20 base pairs, and recognizes single base mismatches and dinucleotide insertion-deletion loops (IDL) in the DNA. After mismatch binding, forms a ternary complex with the MutL alpha heterodimer, which is thought to be responsible for directing the downstream MMR events, including strand discrimination, excision, and resynthesis. ATP binding and hydrolysis play a pivotal role in mismatch repair functions. The ATPase activity associated with MutS alpha regulates binding similar to a molecular switch: mismatched DNA provokes ADP-->ATP exchange, resulting in a discernible conformational transition that converts MutS alpha into a sliding clamp capable of hydrolysis-independent diffusion along the DNA backbone. This transition is crucial for mismatch repair. MutS alpha may also play a role in DNA homologous recombination repair. Recruited on chromatin in G1 and early S phase via its PWWP domain that specifically binds trimethylated 'Lys-36' of histone H3 (H3K36me3): early recruitment to chromatin to be replicated allowing a quick identification of mismatch repair to initiate the DNA mismatch repair reaction.
- Molecular Weight
- 153kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC57727
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat