Antibodies
Anti-MST2 Antibody-Oligo Conjugate
SKU: aoc2767
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MST2 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase 3
- UniProt Number
- Q13188
- Target Description
- Stress-activated, pro-apoptotic kinase which, following caspase-cleavage, enters the nucleus and induces chromatin condensation followed by internucleosomal DNA fragmentation (PubMed:11278283, PubMed:8566796, PubMed:8816758). Key component of the Hippo signaling pathway which plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ (PubMed:15688006, PubMed:16930133, PubMed:23972470, PubMed:28087714, PubMed:29063833, PubMed:30622739). Phosphorylation of YAP1 by LATS2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration (PubMed:15688006, PubMed:16930133, PubMed:23972470, PubMed:28087714). STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation. Phosphorylates NKX2-1 (By similarity). Phosphorylates NEK2 and plays a role in centrosome disjunction by regulating the localization of NEK2 to centrosome, and its ability to phosphorylate CROCC and CEP250 (PubMed:21076410, PubMed:21723128). In conjunction with SAV1, activates the transcriptional activity of ESR1 through the modulation of its phosphorylation (PubMed:21104395). Positively regulates RAF1 activation via suppression of the inhibitory phosphorylation of RAF1 on 'Ser-259' (PubMed:20212043). Phosphorylates MOBKL1A and RASSF2 (PubMed:19525978). Phosphorylates MOBKL1B on 'Thr-74'. Acts cooperatively with MOBKL1B to activate STK38 (PubMed:18328708, PubMed:18362890)..
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1389
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse