Antibodies
Anti-MST2 Antibody-Oligo Conjugate
SKU: aoc2767
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MST2 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase 3
- UniProt Number
- Q13188
- Target Description
- Stress-activated, pro-apoptotic kinase which, following caspase-cleavage, enters the nucleus and induces chromatin condensation followed by internucleosomal DNA fragmentation. Key component of the Hippo signaling pathway which plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. STK3/MST2 and STK4/MST1 are required to repress proliferation of mature hepatocytes, to prevent activation of facultative adult liver stem cells (oval cells), and to inhibit tumor formation. Phosphorylates NKX2-1. Phosphorylates NEK2 and plays a role in centrosome disjunction by regulating the localization of NEK2 to centrosome, and its ability to phosphorylate CROCC and CEP250. In conjunction with SAV1, activates the transcriptional activity of ESR1 through the modulation of its phosphorylation. Positively regulates RAF1 activation via suppression of the inhibitory phosphorylation of RAF1 on 'Ser-259'. Phosphorylates MOBKL1A and RASSF2. Phosphorylates MOBKL1B on 'Thr-74'. Acts cooperatively with MOBKL1B to activate STK38.
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1389
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse