Antibodies
Anti-MTAP Antibody-Oligo Conjugate (ARC2872)
SKU: aoc2770
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MTAP Antibody (ARC2872)-IF1
Antibody Target
- Target
- S-methyl-5'-thioadenosine phosphorylase
- UniProt Number
- Q13126
- Target Description
- Catalyzes the reversible phosphorylation of S-methyl-5'-thioadenosine (MTA) to adenine and 5-methylthioribose-1-phosphate. Involved in the breakdown of MTA, a major by-product of polyamine biosynthesis. Responsible for the first step in the methionine salvage pathway after MTA has been generated from S-adenosylmethionine. Has broad substrate specificity with 6-aminopurine nucleosides as preferred substrates.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC2872
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat