Antibodies
Anti-MTCO2 Antibody-Oligo Conjugate (ARC75611)
SKU: aoc2772
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MTCO2 Antibody (ARC75611)-IF1
Antibody Target
- Target
- Cytochrome c oxidase subunit 2
- UniProt Number
- P00403
- Target Description
- Component of the cytochrome c oxidase, the last enzyme in the mitochondrial electron transport chain which drives oxidative phosphorylation. The respiratory chain contains 3 multisubunit complexes succinate dehydrogenase (complex II, CII), ubiquinol-cytochrome c oxidoreductase (cytochrome b-c1 complex, complex III, CIII) and cytochrome c oxidase (complex IV, CIV), that cooperate to transfer electrons derived from NADH and succinate to molecular oxygen, creating an electrochemical gradient over the inner membrane that drives transmembrane transport and the ATP synthase. Cytochrome c oxidase is the component of the respiratory chain that catalyzes the reduction of oxygen to water. Electrons originating from reduced cytochrome c in the intermembrane space (IMS) are transferred via the dinuclear copper A center (CU(A)) of subunit 2 and heme A of subunit 1 to the active site in subunit 1, a binuclear center (BNC) formed by heme A3 and copper B (CU(B)). The BNC reduces molecular oxygen to 2 water molecules using 4 electrons from cytochrome c in the IMS and 4 protons from the mitochondrial matrix.
- Molecular Weight
- 26 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC75611
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat