Antibodies
Anti-MUC2 Antibody-Oligo Conjugate (ARC1012)
SKU: aoc2782
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MUC2 Antibody (ARC1012)-IF1
Antibody Target
- Target
- Mucin-2
- UniProt Number
- Q02817
- Target Description
- Coats the epithelia of the intestines and other mucus membrane-containing organs to provide a protective, lubricating barrier against particles and infectious agents at mucosal surfaces (PubMed:17058067, PubMed:19432394, PubMed:33031746). Major constituent of the colon mucus, which is mainly formed by large polymeric networks of MUC2 secreted by goblet cells that cover the exposed surfaces of intestine (PubMed:19432394, PubMed:33031746). MUC2 networks form hydrogels that guard the underlying epithelium from pathogens and other hazardous matter entering from the outside world, while permitting nutrient absorption and gas exchange (PubMed:33031746, PubMed:36206754). Acts as a divalent copper chaperone that protects intestinal cells from copper toxicity and facilitates nutritional copper unptake into cells (PubMed:36206754). Binds both Cu(2+) and its reduced form, Cu(1+), at two juxtaposed binding sites: Cu(2+), once reduced to Cu(1+) by vitamin C (ascorbate) or other dietary antioxidants, transits to the other binding site (PubMed:36206754). MUC2-bound Cu(1+) is protected from oxidation in aerobic environments, and can be released for nutritional delivery to cells (PubMed:36206754). Mucin gels store antimicrobial molecules that participate in innate immunity (PubMed:33031746). Mucin glycoproteins also house and feed the microbiome, lubricate tissue surfaces, and may facilitate the removal of contaminants and waste products from the body (PubMed:33031746). Goblet cells synthesize two forms of MUC2 mucin that differ in branched chain O-glycosylation and the site of production in the colon: a (1) 'thick' mucus that wraps the microbiota to form fecal pellets is produced in the proximal, ascending colon (By similarity). 'Thick' mucus transits along the descending colon and is lubricated by a (2) 'thin' MUC2 mucus produced in the distal colon which adheres to the 'thick' mucus (By similarity)..
- Molecular Weight
- 551 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1012
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat