Antibodies
Anti-MUC2 Antibody-Oligo Conjugate (ARC1012)
SKU: aoc2782
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MUC2 Antibody (ARC1012)-IF1
Antibody Target
- Target
- Mucin-2
- UniProt Number
- Q02817
- Target Description
- Coats the epithelia of the intestines and other mucus membrane-containing organs to provide a protective, lubricating barrier against particles and infectious agents at mucosal surfaces. Major constituent of the colon mucus, which is mainly formed by large polymeric networks of MUC2 secreted by goblet cells that cover the exposed surfaces of intestine. MUC2 networks form hydrogels that guard the underlying epithelium from pathogens and other hazardous matter entering from the outside world, while permitting nutrient absorption and gas exchange. Acts as a divalent copper chaperone that protects intestinal cells from copper toxicity and facilitates nutritional copper unptake into cells. Binds both Cu(2+) and its reduced form, Cu(1+), at two juxtaposed binding sites: Cu(2+), once reduced to Cu(1+) by vitamin C (ascorbate) or other dietary antioxidants, transits to the other binding site. MUC2-bound Cu(1+) is protected from oxidation in aerobic environments, and can be released for nutritional delivery to cells. Mucin gels store antimicrobial molecules that participate in innate immunity. Mucin glycoproteins also house and feed the microbiome, lubricate tissue surfaces, and may facilitate the removal of contaminants and waste products from the body. Goblet cells synthesize two forms of MUC2 mucin that differ in branched chain O-glycosylation and the site of production in the colon: a (1) 'thick' mucus that wraps the microbiota to form fecal pellets is produced in the proximal, ascending colon. 'Thick' mucus transits along the descending colon and is lubricated by a (2) 'thin' MUC2 mucus produced in the distal colon which adheres to the 'thick' mucus.
- Molecular Weight
- 551 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1012
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat