Antibodies
Anti-MUC4 Antibody-Oligo Conjugate
SKU: aoc2783
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MUC4 Antibody-IF1
Antibody Target
- Target
- Mucin-4
- UniProt Number
- Q99102
- Target Description
- Membrane-bound mucin, a family of highly glycosylated proteins that constitute the major component of the mucus, the slimy and viscous secretion covering epithelial surfaces (PubMed:10880978). These glycoproteins play important roles in the protection of the epithelium and are implicated in epithelial renewal and differentiation (PubMed:10880978). Regulates cellular behavior through both anti-adhesive effects on cell-cell and cell-extracellular matrix interactions and its ability to act as an intramembrane ligand for ERBB2. Plays an important role in proliferation and differentiation of epithelial cells by inducing specific phosphorylation of ERBB2. In polarized epithelial cells, segregates ERBB2 and other ERBB receptors and prevents ERBB2 from acting as a coreceptor. The interaction with ERBB2 leads to enhanced expression of CDKN1B. The formation of a MUC4-ERBB2-ERBB3-NRG1 complex leads to down-regulation of CDKN1B, resulting in repression of apoptosis and stimulation of proliferation. Its ability to promote tumor growth may be mainly due to repression of apoptosis as opposed to proliferation..
- Molecular Weight
- 542kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1999
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat