Antibodies
Anti-Musashi 1 / Msi1 Antibody-Oligo Conjugate
SKU: aoc2784
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Musashi 1 / Msi1 Antibody-IF1
Antibody Target
- Target
- RNA-binding protein Musashi homolog 1
- UniProt Number
- O43347
- Target Description
- RNA binding protein that regulates the expression of target mRNAs at the translation level. Regulates expression of the NOTCH1 antagonist NUMB. Binds RNA containing the sequence 5'-GUUAGUUAGUUAGUU-3' and other sequences containing the pattern 5'-[GA]U(1-3)AGU-3'. May play a role in the proliferation and maintenance of stem cells in the central nervous system.
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1796
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse