Antibodies
Anti-MVP Antibody-Oligo Conjugate (ARC64517)
SKU: aoc2789
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MVP Antibody (ARC64517)-IF1
Antibody Target
- Target
- Major vault protein
- UniProt Number
- Q14764
- Target Description
- Required for normal vault structure. Vaults are multi-subunit structures that may act as scaffolds for proteins involved in signal transduction. Vaults may also play a role in nucleo-cytoplasmic transport. Down-regulates IFNG-mediated STAT1 signaling and subsequent activation of JAK. Down-regulates SRC activity and signaling through MAP kinases..
- Molecular Weight
- 99kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC64517
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat