Antibodies
Anti-MYD88 Antibody-Oligo Conjugate (ARC52507)
SKU: aoc2791
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MYD88 Antibody (ARC52507)-IF1
Antibody Target
- Target
- Myeloid differentiation primary response protein MyD88
- UniProt Number
- Q99836
- Target Description
- Adapter protein involved in the Toll-like receptor and IL-1 receptor signaling pathway in the innate immune response. Acts via IRAK1, IRAK2, IRF7 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. Increases IL-8 transcription. Involved in IL-18-mediated signaling pathway. Activates IRF1 resulting in its rapid migration into the nucleus to mediate an efficient induction of IFN-beta, NOS2/INOS, and IL12A genes. Upon TLR8 activation by GU-rich single-stranded RNA (GU-rich RNA) derived from viruses such as SARS-CoV-2, SARS-CoV and HIV-1, induces IL1B release through NLRP3 inflammasome activation. MyD88-mediated signaling in intestinal epithelial cells is crucial for maintenance of gut homeostasis and controls the expression of the antimicrobial lectin REG3G in the small intestine.
- Molecular Weight
- 15kDa/20kDa/28kDa/31kDa/33kDa/34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52507
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat