Antibodies
Anti-Myelin Basic Protein Antibody-Oligo Conjugate
SKU: aoc2793
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Myelin Basic Protein Antibody-IF1
Antibody Target
- Target
- Myelin basic protein
- UniProt Number
- P02686
- Target Description
- The classic group of MBP isoforms (isoform 4-isoform 14) are with PLP the most abundant protein components of the myelin membrane in the CNS. They have a role in both its formation and stabilization. The smaller isoforms might have an important role in remyelination of denuded axons in multiple sclerosis. The non-classic group of MBP isoforms (isoform 1-isoform 3/Golli-MBPs) may preferentially have a role in the early developing brain long before myelination, maybe as components of transcriptional complexes, and may also be involved in signaling pathways in T-cells and neural cells. Differential splicing events combined with optional post-translational modifications give a wide spectrum of isomers, with each of them potentially having a specialized function. Induces T-cell proliferation..
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC67024
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat