Antibodies
Anti-MYL12B Antibody-Oligo Conjugate
SKU: aoc2802
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MYL12B Antibody-IF1
Antibody Target
- Target
- Myosin regulatory light chain 12B
- UniProt Number
- O14950
- Target Description
- Myosin regulatory subunit that plays an important role in regulation of both smooth muscle and nonmuscle cell contractile activity via its phosphorylation. Phosphorylation triggers actin polymerization in vascular smooth muscle. Implicated in cytokinesis, receptor capping, and cell locomotion.
- Molecular Weight
- 20kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2712
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat