Antibodies
Anti-Myoglobin Antibody-Oligo Conjugate (ARC65610)
SKU: aoc2808
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Myoglobin Antibody (ARC65610)-IF1
Antibody Target
- Target
- Myoglobin
- UniProt Number
- P02144
- Target Description
- Monomeric heme protein which primary function is to store oxygen and facilitate its diffusion within muscle tissues. Reversibly binds oxygen through a pentacoordinated heme iron and enables its timely and efficient release as needed during periods of heightened demand (PubMed:30918256, PubMed:34679218). Depending on the oxidative conditions of tissues and cells, and in addition to its ability to bind oxygen, it also has a nitrite reductase activity whereby it regulates the production of bioactive nitric oxide (PubMed:32891753). Under stress conditions, like hypoxia and anoxia, it also protects cells against reactive oxygen species thanks to its pseudoperoxidase activity (PubMed:34679218)..
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC65610
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat