Antibodies
Anti-Myoglobin Antibody-Oligo Conjugate (AMC50106)
SKU: aoc2809
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Myoglobin Antibody (AMC50106)-IF1
Antibody Target
- Target
- Myoglobin
- UniProt Number
- P02144
- Target Description
- Monomeric heme protein which primary function is to store oxygen and facilitate its diffusion within muscle tissues. Reversibly binds oxygen through a pentacoordinated heme iron and enables its timely and efficient release as needed during periods of heightened demand. Depending on the oxidative conditions of tissues and cells, and in addition to its ability to bind oxygen, it also has a nitrite reductase activity whereby it regulates the production of bioactive nitric oxide. Under stress conditions, like hypoxia and anoxia, it also protects cells against reactive oxygen species thanks to its pseudoperoxidase activity.
- Molecular Weight
- 17 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- AMC50106
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat