Antibodies
Anti-Myosin heavy chain Antibody-Oligo Conjugate
SKU: aoc2810
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Myosin heavy chain Antibody-IF1
Antibody Target
- Target
- Myosin-7
- UniProt Number
- P12883
- Additional Target Information
- This antibody also binds Myosin-6, Uniprot:P13533.
- Target Description
- Myosins are actin-based motor molecules with ATPase activity essential for muscle contraction. Forms regular bipolar thick filaments that, together with actin thin filaments, constitute the fundamental contractile unit of skeletal and cardiac muscle.
- Molecular Weight
- 224 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC1170
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat