Antibodies
Anti-NAIP Antibody-Oligo Conjugate
SKU: aoc2814
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NAIP Antibody-IF1
Antibody Target
- Target
- Baculoviral IAP repeat-containing protein 1
- UniProt Number
- Q13075
- Target Description
- Anti-apoptotic protein which acts by inhibiting the activities of CASP3, CASP7 and CASP9. Can inhibit the autocleavage of pro-CASP9 and cleavage of pro-CASP3 by CASP9. Capable of inhibiting CASP9 autoproteolysis at 'Asp-315' and decreasing the rate of auto proteolysis at 'Asp-330'. Acts as a mediator of neuronal survival in pathological conditions. Prevents motor-neuron apoptosis induced by a variety of signals. Possible role in the prevention of spinal muscular atrophy that seems to be caused by inappropriate persistence of motor-neuron apoptosis: mutated or deleted forms of NAIP have been found in individuals with severe spinal muscular atrophy.; FUNCTION: Acts as a sensor component of the NLRC4 inflammasome that specifically recognizes and binds needle protein CprI from pathogenic bacteria C.violaceum. Association of pathogenic bacteria proteins drives in turn drive assembly and activation of the NLRC4 inflammasome, promoting caspase-1 activation, cytokine production and macrophage pyroptosis. The NLRC4 inflammasome is activated as part of the innate immune response to a range of intracellular bacteria such as C.violaceum and L.pneumophila.
- Molecular Weight
- 160kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC2258
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse