Antibodies
Anti-NAP1L1 Antibody-Oligo Conjugate
SKU: aoc2817
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NAP1L1 Antibody-IF1
Antibody Target
- Target
- Nucleosome assembly protein 1-like 1
- UniProt Number
- P55209
- Target Description
- Histone chaperone that plays a role in the nuclear import of H2A-H2B and nucleosome assembly (PubMed:20002496, PubMed:21211722, PubMed:26841755). Also participates in several important DNA repair mechanisms: greatly enhances ERCC6-mediated chromatin remodeling which is essential for transcription-coupled nucleotide excision DNA repair (PubMed:28369616). Also stimulates homologous recombination (HR) by RAD51 and RAD54 which is essential in mitotic DNA double strand break (DSB) repair (PubMed:24798879). Plays a key role in the regulation of embryonic neurogenesis (By similarity). Promotes the proliferation of neural progenitors and inhibits neuronal differentiation during cortical development (By similarity). Regulates neurogenesis via the modulation of RASSF10; regulates RASSF10 expression by promoting SETD1A-mediated H3K4 methylation at the RASSF10 promoter (By similarity)..; FUNCTION: (Microbial infection) Positively regulates Epstein-Barr virus reactivation in epithelial cells through the induction of viral BZLF1 expression..; FUNCTION: (Microbial infection) Together with human herpesvirus 8 protein LANA1, assists the proper assembly of the nucleosome on the replicated viral DNA..
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1888
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat