Antibodies
Anti-NAP1L1 Antibody-Oligo Conjugate
SKU: aoc2817
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NAP1L1 Antibody-IF1
Antibody Target
- Target
- Nucleosome assembly protein 1-like 1
- UniProt Number
- P55209
- Target Description
- Histone chaperone that plays a role in the nuclear import of H2A-H2B and nucleosome assembly. Also participates in several important DNA repair mechanisms: greatly enhances ERCC6-mediated chromatin remodeling which is essential for transcription-coupled nucleotide excision DNA repair. Also stimulates homologous recombination (HR) by RAD51 and RAD54 which is essential in mitotic DNA double strand break (DSB) repair. Plays a key role in the regulation of embryonic neurogenesis. Promotes the proliferation of neural progenitors and inhibits neuronal differentiation during cortical development. Regulates neurogenesis via the modulation of RASSF10; regulates RASSF10 expression by promoting SETD1A-mediated H3K4 methylation at the RASSF10 promoter.; FUNCTION: (Microbial infection) Positively regulates Epstein-Barr virus reactivation in epithelial cells through the induction of viral BZLF1 expression.; FUNCTION: (Microbial infection) Together with human herpesvirus 8 protein LANA1, assists the proper assembly of the nucleosome on the replicated viral DNA.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1888
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat