Antibodies
Anti-NAT10 Antibody-Oligo Conjugate
SKU: aoc2819
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NAT10 Antibody-IF1
Antibody Target
- Target
- RNA cytidine acetyltransferase
- UniProt Number
- Q9H0A0
- Target Description
- RNA cytidine acetyltransferase that catalyzes the formation of N(4)-acetylcytidine (ac4C) modification on mRNAs, 18S rRNA and tRNAs (PubMed:25411247, PubMed:25653167, PubMed:30449621, PubMed:35679869). Catalyzes ac4C modification of a broad range of mRNAs, enhancing mRNA stability and translation (PubMed:30449621, PubMed:35679869). mRNA ac4C modification is frequently present within wobble cytidine sites and promotes translation efficiency (PubMed:30449621). Mediates the formation of ac4C at position 1842 in 18S rRNA (PubMed:25411247). May also catalyze the formation of ac4C at position 1337 in 18S rRNA (By similarity). Required for early nucleolar cleavages of precursor rRNA at sites A0, A1 and A2 during 18S rRNA synthesis (PubMed:25411247, PubMed:25653167). Catalyzes the formation of ac4C in serine and leucine tRNAs (By similarity). Requires the tRNA-binding adapter protein THUMPD1 for full tRNA acetyltransferase activity but not for 18S rRNA acetylation (PubMed:25653167). In addition to RNA acetyltransferase activity, also able to acetylate lysine residues of proteins, such as histones, microtubules, p53/TP53 and MDM2, in vitro (PubMed:14592445, PubMed:17631499, PubMed:19303003, PubMed:26882543, PubMed:27993683, PubMed:30165671). The relevance of the protein lysine acetyltransferase activity is however unsure in vivo (PubMed:30449621). Activates telomerase activity by stimulating the transcription of TERT, and may also regulate telomerase function by affecting the balance of telomerase subunit assembly, disassembly, and localization (PubMed:14592445, PubMed:18082603). Involved in the regulation of centrosome duplication by acetylating CENATAC during mitosis, promoting SASS6 proteasome degradation (PubMed:31722219). Part of the small subunit (SSU) processome, first precursor of the small eukaryotic ribosomal subunit. During the assembly of the SSU processome in the nucleolus, many ribosome biogenesis factors, an RNA chaperone and ribosomal proteins associate with the nascent pre-rRNA and work in concert to generate RNA folding, modifications, rearrangements and cleavage as well as targeted degradation of pre-ribosomal RNA by the RNA exosome (PubMed:34516797)..
- Molecular Weight
- 116 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2468
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat