AntibodiesNeuroMab
Anti-Nav1.6 Na+ Channel Antibody-Oligo Conjugate
SKU: aoc18
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Nav1.6 Na+ Channel Antibody-IF1
Antibody Target
- Target
- Nav1.6 Na+ channel
- UniProt Number
- Q9UQD0
- Target Description
- Nav1.6 Na+ channel (sodium channel, voltage-gated, type 8, alpha subunit/ SCN8A) is a member of voltage-gated sodium ion channel subunit family. It is encoded by gene Scn8a in human.The channel switches between open and close conformation in response to the voltage difference accross the membrane. Nav1.6 Na+ channel is located at the nodes of Ranvier. It heavily participates in the regulation of nerve conduction velocity. It has been shown that Nav1.6 Na+ channel loss in roddents induces paralysis due to the failure of the neuromuscular junction (Wagnon et al., 2016).
- Molecular Weight
- <200 kDa
- Synonyms
- Sodium channel protein type 8 subunit alpha (Peripheral nerve protein type 4) (PN4) (Sodium channel 6) (NaCh6) (Sodium channel protein type VIII subunit alpha) (Voltage-gated sodium channel subunit alpha Nav1.6)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- K87A/10
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide 459-476 (intracellular interdomain loop I-II) of rat Nav1.6 (accession number O88420)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat