Antibodies

Anti-NBS1 Antibody-Oligo Conjugate

SKU: aoc2820

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Proximity Ligation Assay Oligossee protocol

PLA1 Oligo Details

5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'

View Paper

An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.

Anti-NBS1 Antibody-PLA1

Antibody Target

Target
Nibrin
UniProt Number
O60934
Target Description
Component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis (PubMed:10888888, PubMed:15616588, PubMed:18411307, PubMed:18583988, PubMed:18678890, PubMed:19759395, PubMed:23115235, PubMed:28216226, PubMed:28867292, PubMed:9705271). The MRN complex is involved in the repair of DNA double-strand breaks (DSBs) via homologous recombination (HR), an error-free mechanism which primarily occurs during S and G2 phases (PubMed:19759395, PubMed:28867292, PubMed:9705271). The complex (1) mediates the end resection of damaged DNA, which generates proper single-stranded DNA, a key initial steps in HR, and is (2) required for the recruitment of other repair factors and efficient activation of ATM and ATR upon DNA damage (PubMed:19759395, PubMed:9705271). The MRN complex possesses single-strand endonuclease activity and double-strand-specific 3'-5' exonuclease activity, which are provided by MRE11, to initiate end resection, which is required for single-strand invasion and recombination (PubMed:19759395, PubMed:28867292, PubMed:9705271). Within the MRN complex, NBN acts as a protein-protein adapter, which specifically recognizes and binds phosphorylated proteins, promoting their recruitment to DNA damage sites (PubMed:12419185, PubMed:15616588, PubMed:18411307, PubMed:18582474, PubMed:18583988, PubMed:18678890, PubMed:19759395, PubMed:19804756, PubMed:23762398, PubMed:24534091, PubMed:27814491, PubMed:27889449, PubMed:33836577). Recruits MRE11 and RAD50 components of the MRN complex to DSBs in response to DNA damage (PubMed:12419185, PubMed:18411307, PubMed:18583988, PubMed:18678890, PubMed:24534091, PubMed:26438602). Promotes the recruitment of PI3/PI4-kinase family members ATM, ATR, and probably DNA-PKcs to the DNA damage sites, activating their functions (PubMed:15064416, PubMed:15616588, PubMed:15790808, PubMed:16622404, PubMed:22464731, PubMed:30952868, PubMed:35076389). Mediates the recruitment of phosphorylated RBBP8/CtIP to DSBs, leading to cooperation between the MRN complex and RBBP8/CtIP to initiate end resection (PubMed:19759395, PubMed:27814491, PubMed:27889449, PubMed:33836577). RBBP8/CtIP specifically promotes the endonuclease activity of the MRN complex to clear DNA ends containing protein adducts (PubMed:27814491, PubMed:27889449, PubMed:30787182, PubMed:33836577). The MRN complex is also required for the processing of R-loops (PubMed:31537797). NBN also functions in telomere length maintenance via its interaction with TERF2: interaction with TERF2 during G1 phase preventing recruitment of DCLRE1B/Apollo to telomeres (PubMed:10888888, PubMed:28216226). NBN also promotes DNA repair choice at dysfunctional telomeres: NBN phosphorylation by CDK2 promotes non-homologous end joining repair at telomeres, while unphosphorylated NBN promotes microhomology-mediated end-joining (MMEJ) repair (PubMed:28216226). Enhances AKT1 phosphorylation possibly by association with the mTORC2 complex (PubMed:23762398)..
Molecular Weight
85kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIPELISA
Clone
ARC0926
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human