Antibodies
Anti-NBS1 Antibody-Oligo Conjugate
SKU: aoc2820
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-NBS1 Antibody-PLA1
Antibody Target
- Target
- Nibrin
- UniProt Number
- O60934
- Target Description
- Component of the MRN complex, which plays a central role in double-strand break (DSB) repair, DNA recombination, maintenance of telomere integrity and meiosis (PubMed:10888888, PubMed:15616588, PubMed:18411307, PubMed:18583988, PubMed:18678890, PubMed:19759395, PubMed:23115235, PubMed:28216226, PubMed:28867292, PubMed:9705271). The MRN complex is involved in the repair of DNA double-strand breaks (DSBs) via homologous recombination (HR), an error-free mechanism which primarily occurs during S and G2 phases (PubMed:19759395, PubMed:28867292, PubMed:9705271). The complex (1) mediates the end resection of damaged DNA, which generates proper single-stranded DNA, a key initial steps in HR, and is (2) required for the recruitment of other repair factors and efficient activation of ATM and ATR upon DNA damage (PubMed:19759395, PubMed:9705271). The MRN complex possesses single-strand endonuclease activity and double-strand-specific 3'-5' exonuclease activity, which are provided by MRE11, to initiate end resection, which is required for single-strand invasion and recombination (PubMed:19759395, PubMed:28867292, PubMed:9705271). Within the MRN complex, NBN acts as a protein-protein adapter, which specifically recognizes and binds phosphorylated proteins, promoting their recruitment to DNA damage sites (PubMed:12419185, PubMed:15616588, PubMed:18411307, PubMed:18582474, PubMed:18583988, PubMed:18678890, PubMed:19759395, PubMed:19804756, PubMed:23762398, PubMed:24534091, PubMed:27814491, PubMed:27889449, PubMed:33836577). Recruits MRE11 and RAD50 components of the MRN complex to DSBs in response to DNA damage (PubMed:12419185, PubMed:18411307, PubMed:18583988, PubMed:18678890, PubMed:24534091, PubMed:26438602). Promotes the recruitment of PI3/PI4-kinase family members ATM, ATR, and probably DNA-PKcs to the DNA damage sites, activating their functions (PubMed:15064416, PubMed:15616588, PubMed:15790808, PubMed:16622404, PubMed:22464731, PubMed:30952868, PubMed:35076389). Mediates the recruitment of phosphorylated RBBP8/CtIP to DSBs, leading to cooperation between the MRN complex and RBBP8/CtIP to initiate end resection (PubMed:19759395, PubMed:27814491, PubMed:27889449, PubMed:33836577). RBBP8/CtIP specifically promotes the endonuclease activity of the MRN complex to clear DNA ends containing protein adducts (PubMed:27814491, PubMed:27889449, PubMed:30787182, PubMed:33836577). The MRN complex is also required for the processing of R-loops (PubMed:31537797). NBN also functions in telomere length maintenance via its interaction with TERF2: interaction with TERF2 during G1 phase preventing recruitment of DCLRE1B/Apollo to telomeres (PubMed:10888888, PubMed:28216226). NBN also promotes DNA repair choice at dysfunctional telomeres: NBN phosphorylation by CDK2 promotes non-homologous end joining repair at telomeres, while unphosphorylated NBN promotes microhomology-mediated end-joining (MMEJ) repair (PubMed:28216226). Enhances AKT1 phosphorylation possibly by association with the mTORC2 complex (PubMed:23762398)..
- Molecular Weight
- 85kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0926
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human