Antibodies
Anti-NCK1 Antibody-Oligo Conjugate
SKU: aoc2825
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NCK1 Antibody-IF1
Antibody Target
- Target
- SH2/SH3 adapter protein NCK1
- UniProt Number
- P16333
- Target Description
- Adapter protein which associates with tyrosine-phosphorylated growth factor receptors, such as KDR and PDGFRB, or their cellular substrates. Maintains low levels of EIF2S1 phosphorylation by promoting its dephosphorylation by PP1. Plays a role in the DNA damage response, not in the detection of the damage by ATM/ATR, but for efficient activation of downstream effectors, such as that of CHEK2. Plays a role in ELK1-dependent transcriptional activation in response to activated Ras signaling. Modulates the activation of EIF2AK2/PKR by dsRNA. May play a role in cell adhesion and migration through interaction with ephrin receptors..
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1441
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat