Antibodies
Anti-NDRG1 Antibody-Oligo Conjugate
SKU: aoc2832
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDRG1 Antibody-IF1
Antibody Target
- Target
- Protein NDRG1
- UniProt Number
- Q92597
- Target Description
- Stress-responsive protein involved in hormone responses, cell growth, and differentiation. Acts as a tumor suppressor in many cell types. Necessary but not sufficient for p53/TP53-mediated caspase activation and apoptosis. Has a role in cell trafficking, notably of the Schwann cell, and is necessary for the maintenance and development of the peripheral nerve myelin sheath. Required for vesicular recycling of CDH1 and TF. May also function in lipid trafficking. Protects cells from spindle disruption damage. Functions in p53/TP53-dependent mitotic spindle checkpoint. Regulates microtubule dynamics and maintains euploidy..
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0887
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat