Antibodies
Anti-NDUFAB1 Antibody-Oligo Conjugate
SKU: aoc2834
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFAB1 Antibody-IF1
Antibody Target
- Target
- Acyl carrier protein, mitochondrial
- UniProt Number
- O14561
- Target Description
- Carrier of the growing fatty acid chain in fatty acid biosynthesis (By similarity) (PubMed:27626371). Accessory and non-catalytic subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), which functions in the transfer of electrons from NADH to the respiratory chain (PubMed:27626371). Accessory protein, of the core iron-sulfur cluster (ISC) assembly complex, that regulates, in association with LYRM4, the stability and the cysteine desulfurase activity of NFS1 and participates in the [2Fe-2S] clusters assembly on the scaffolding protein ISCU (PubMed:31664822). The core iron-sulfur cluster (ISC) assembly complex is involved in the de novo synthesis of a [2Fe-2S] cluster, the first step of the mitochondrial iron-sulfur protein biogenesis. This process is initiated by the cysteine desulfurase complex (NFS1:LYRM4:NDUFAB1) that produces persulfide which is delivered on the scaffold protein ISCU in a FXN-dependent manner. Then this complex is stabilized by FDX2 which provides reducing equivalents to accomplish the [2Fe-2S] cluster assembly. Finally, the [2Fe-2S] cluster is transferred from ISCU to chaperone proteins, including HSCB, HSPA9 and GLRX5 (By similarity)..
- Molecular Weight
- 17kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3068
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat