Antibodies
Anti-NDUFS1 Antibody-Oligo Conjugate
SKU: aoc2840
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFS1 Antibody-IF1
Antibody Target
- Target
- NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial
- UniProt Number
- P28331
- Target Description
- Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which catalyzes electron transfer from NADH through the respiratory chain, using ubiquinone as an electron acceptor. Essential for catalysing the entry and efficient transfer of electrons within complex I. Plays a key role in the assembly and stability of complex I and participates in the association of complex I with ubiquinol-cytochrome reductase complex (Complex III) to form supercomplexes.
- Molecular Weight
- 79kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52613
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat