Antibodies
Anti-NDUFS1 Antibody-Oligo Conjugate
SKU: aoc2840
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFS1 Antibody-IF1
Antibody Target
- Target
- NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial
- UniProt Number
- P28331
- Target Description
- Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which catalyzes electron transfer from NADH through the respiratory chain, using ubiquinone as an electron acceptor (PubMed:30879903, PubMed:31557978). Essential for catalysing the entry and efficient transfer of electrons within complex I (PubMed:31557978). Plays a key role in the assembly and stability of complex I and participates in the association of complex I with ubiquinol-cytochrome reductase complex (Complex III) to form supercomplexes (PubMed:30879903, PubMed:31557978)..
- Molecular Weight
- 79kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52613
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat