Antibodies
Anti-NDUFS3 Antibody-Oligo Conjugate (ARC55923)
SKU: aoc2842
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFS3 Antibody (ARC55923)-IF1
Antibody Target
- Target
- NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial
- UniProt Number
- O75489
- Target Description
- Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which catalyzes electron transfer from NADH through the respiratory chain, using ubiquinone as an electron acceptor. Essential for the catalytic activity and assembly of complex I.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC55923
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat