Antibodies
Anti-NDUFS3 Antibody-Oligo Conjugate (ARC1049)
SKU: aoc2843
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFS3 Antibody (ARC1049)-IF1
Antibody Target
- Target
- NADH dehydrogenase [ubiquinone] iron-sulfur protein 3, mitochondrial
- UniProt Number
- O75489
- Target Description
- Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which catalyzes electron transfer from NADH through the respiratory chain, using ubiquinone as an electron acceptor (PubMed:14729820, PubMed:30140060). Essential for the catalytic activity and assembly of complex I (PubMed:14729820, PubMed:24028823, PubMed:30140060)..
- Molecular Weight
- 30 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1049
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanRat