Antibodies
Anti-NDUFV1 Antibody-Oligo Conjugate
SKU: aoc2846
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFV1 Antibody-IF1
Antibody Target
- Target
- NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial
- UniProt Number
- P49821
- Target Description
- Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which catalyzes electron transfer from NADH through the respiratory chain, using ubiquinone as an electron acceptor. Part of the peripheral arm of the enzyme, where the electrons from NADH are accepted by flavin mononucleotide (FMN) and then passed along a chain of iron-sulfur clusters by electron tunnelling to the final acceptor ubiquinone. Contains FMN, which is the initial electron acceptor as well as one iron-sulfur cluster.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57616
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat