Antibodies
Anti-NDUFV1 Antibody-Oligo Conjugate
SKU: aoc2846
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NDUFV1 Antibody-IF1
Antibody Target
- Target
- NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial
- UniProt Number
- P49821
- Target Description
- Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which catalyzes electron transfer from NADH through the respiratory chain, using ubiquinone as an electron acceptor (PubMed:28844695). Part of the peripheral arm of the enzyme, where the electrons from NADH are accepted by flavin mononucleotide (FMN) and then passed along a chain of iron-sulfur clusters by electron tunnelling to the final acceptor ubiquinone (PubMed:28844695). Contains FMN, which is the initial electron acceptor as well as one iron-sulfur cluster (PubMed:28844695)..
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57616
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat