Antibodies
Anti-Nectin 2 Antibody-Oligo Conjugate
SKU: aoc2847
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Nectin 2 Antibody-IF1
Antibody Target
- Target
- Nectin-2
- UniProt Number
- Q92692
- Target Description
- Modulator of T-cell signaling. Can be either a costimulator of T-cell function, or a coinhibitor, depending on the receptor it binds to. Upon binding to CD226, stimulates T-cell proliferation and cytokine production, including that of IL2, IL5, IL10, IL13, and IFNG. Upon interaction with PVRIG, inhibits T-cell proliferation. These interactions are competitive. Probable cell adhesion protein.; FUNCTION: (Microbial infection) Acts as a receptor for herpes simplex virus 1 (HHV-1) mutant Rid1, herpes simplex virus 1 (HHV-2) and pseudorabies virus (PRV).
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1665
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat