Antibodies
Anti-NEK6 Antibody-Oligo Conjugate
SKU: aoc2852
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NEK6 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase Nek6
- UniProt Number
- Q9HC98
- Target Description
- Protein kinase which plays an important role in mitotic cell cycle progression. Required for chromosome segregation at metaphase-anaphase transition, robust mitotic spindle formation and cytokinesis. Phosphorylates ATF4, CIR1, PTN, RAD26L, RBBP6, RPS7, RPS6KB1, TRIP4, STAT3 and histones H1 and H3. Phosphorylates KIF11 to promote mitotic spindle formation. Involved in G2/M phase cell cycle arrest induced by DNA damage. Inhibition of activity results in apoptosis. May contribute to tumorigenesis by suppressing p53/TP53-induced cancer cell senescence. Phosphorylates EML4 at 'Ser-144', promoting its dissociation from microtubules during mitosis which is required for efficient chromosome congression.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2034
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat