Antibodies
Anti-Nesprin 1 Antibody-Oligo Conjugate
SKU: aoc2854
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Nesprin 1 Antibody-IF1
Antibody Target
- Target
- Nesprin-1
- UniProt Number
- Q8NF91
- Target Description
- Multi-isomeric modular protein which forms a linking network between organelles and the actin cytoskeleton to maintain the subcellular spatial organization. As a component of the LINC (LInker of Nucleoskeleton and Cytoskeleton) complex involved in the connection between the nuclear lamina and the cytoskeleton. The nucleocytoplasmic interactions established by the LINC complex play an important role in the transmission of mechanical forces across the nuclear envelope and in nuclear movement and positioning. May be involved in nucleus-centrosome attachment and nuclear migration in neural progenitors implicating LINC complex association with SUN1/2 and probably association with cytoplasmic dynein-dynactin motor complexes; SYNE1 and SYNE2 may act redundantly. Required for centrosome migration to the apical cell surface during early ciliogenesis. May be involved in nuclear remodeling during sperm head formation in spermatogenesis; a probable SUN3:SYNE1/KASH1 LINC complex may tether spermatid nuclei to posterior cytoskeletal structures such as the manchette.
- Molecular Weight
- 1011kDa/112kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2307
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse