Antibodies
Anti-Neurofilament Antibody-Oligo Conjugate (ARC0494)
SKU: aoc2860
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Neurofilament Antibody (ARC0494)-PLA1
Antibody Target
- Target
- Neurofilament heavy polypeptide
- UniProt Number
- P12036
- Target Description
- Neurofilaments usually contain three intermediate filament proteins: NEFL, NEFM, and NEFH which are involved in the maintenance of neuronal caliber. NEFH has an important function in mature axons that is not subserved by the two smaller NF proteins. May additionally cooperate with the neuronal intermediate filament proteins PRPH and INA to form neuronal filamentous networks.
- Molecular Weight
- 112kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC0494
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat