Antibodies
Anti-Neutrophil Elastase Antibody-Oligo Conjugate
SKU: aoc2866
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Neutrophil Elastase Antibody-PLA1
Antibody Target
- Target
- Neutrophil elastase
- UniProt Number
- P08246
- Target Description
- Serine protease that modifies the functions of natural killer cells, monocytes and granulocytes. Inhibits C5a-dependent neutrophil enzyme release and chemotaxis. Promotes cleavage of GSDMB, thereby inhibiting pyroptosis. Promotes blood coagulation. Through the activation of the platelet fibrinogen receptor integrin alpha-IIb/beta-3, potentiates platelet aggregation induced by a threshold concentration of cathepsin G (CTSG). Cleaves and thus inactivates tissue factor pathway inhibitor (TFPI). Capable of killing E.coli but not S.aureus in vitro; digests outer membrane protein A (ompA) in E.coli and K.pneumoniae.
- Molecular Weight
- 29 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC1364
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human