Antibodies

Anti-NF-kB p65 Antibody-Oligo Conjugate (ARC51088)

SKU: aoc2872

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-NF-kB p65 Antibody (ARC51088)-IF1

Antibody Target

Target
Transcription factor p65
UniProt Number
Q04206
Target Description
NF-kappa-B is a pleiotropic transcription factor present in almost all cell types and is the endpoint of a series of signal transduction events that are initiated by a vast array of stimuli related to many biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The heterodimeric RELA-NFKB1 complex appears to be most abundant one. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. The NF-kappa-B heterodimeric RELA-NFKB1 and RELA-REL complexes, for instance, function as transcriptional activators. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. The inhibitory effect of I-kappa-B on NF-kappa-B through retention in the cytoplasm is exerted primarily through the interaction with RELA. RELA shows a weak DNA-binding site which could contribute directly to DNA binding in the NF-kappa-B complex. Besides its activity as a direct transcriptional activator, it is also able to modulate promoters accessibility to transcription factors and thereby indirectly regulate gene expression. Associates with chromatin at the NF-kappa-B promoter region via association with DDX1. Essential for cytokine gene expression in T-cells. The NF-kappa-B homodimeric RELA-RELA complex appears to be involved in invasin-mediated activation of IL-8 expression. Key transcription factor regulating the IFN response during SARS-CoV-2 infection.
Molecular Weight
58kDa/59kDa/60kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCIPELISAChIP
Clone
ARC51088
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRatMonkey