Antibodies
Anti-NF-kB p65 Antibody-Oligo Conjugate (AMC0222)
SKU: aoc2873
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-NF-kB p65 Antibody (AMC0222)-IF1
Antibody Target
- Target
- Transcription factor p65
- UniProt Number
- Q04206
- Target Description
- NF-kappa-B is a pleiotropic transcription factor present in almost all cell types and is the endpoint of a series of signal transduction events that are initiated by a vast array of stimuli related to many biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. The heterodimeric RELA-NFKB1 complex appears to be most abundant one. The dimers bind at kappa-B sites in the DNA of their target genes and the individual dimers have distinct preferences for different kappa-B sites that they can bind with distinguishable affinity and specificity. Different dimer combinations act as transcriptional activators or repressors, respectively. The NF-kappa-B heterodimeric RELA-NFKB1 and RELA-REL complexes, for instance, function as transcriptional activators. NF-kappa-B is controlled by various mechanisms of post-translational modification and subcellular compartmentalization as well as by interactions with other cofactors or corepressors. NF-kappa-B complexes are held in the cytoplasm in an inactive state complexed with members of the NF-kappa-B inhibitor (I-kappa-B) family. In a conventional activation pathway, I-kappa-B is phosphorylated by I-kappa-B kinases (IKKs) in response to different activators, subsequently degraded thus liberating the active NF-kappa-B complex which translocates to the nucleus. The inhibitory effect of I-kappa-B on NF-kappa-B through retention in the cytoplasm is exerted primarily through the interaction with RELA. RELA shows a weak DNA-binding site which could contribute directly to DNA binding in the NF-kappa-B complex. Besides its activity as a direct transcriptional activator, it is also able to modulate promoters accessibility to transcription factors and thereby indirectly regulate gene expression. Associates with chromatin at the NF-kappa-B promoter region via association with DDX1. Essential for cytokine gene expression in T-cells. The NF-kappa-B homodimeric RELA-RELA complex appears to be involved in invasin-mediated activation of IL-8 expression. Key transcription factor regulating the IFN response during SARS-CoV-2 infection.
- Molecular Weight
- 60kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- AMC0222
- Isotype
- IgG2b
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat